Brink DNA test results

Y-DNA Test Results (12-markers)
for participants in this project, et. al.
note-The more alleles that match, the closer the relationship.

row	identification	test date	Haplo- group	393	390	19(394)	391	385a	385b	426	388	439	389-1	392	389-2
1	001 Brink	2006	R1b1	14	25	15	10	11	14	12	12	12	14	13	30
2	002 Brink	2006	R1b1	13	24	14	10	11	14	12	12	12	14	13	30
3	003 Brinck	2008	R1a	13	25	16	10	11	14	12	12	11	13	11	29
4	004 Brink	2008	Q1a3	13	24	13	10	15	18	12	12	11	12	16	29
5	005 Brink	2008	G	12	22	15	10	14	15	11	13	12	12	11	29
6	006 Brink	2009	R1b1b2a	12	23	14	11	10	14	12	12	12	13	12	30
7	007 Brink	2010		13	24	14	11	11	14	12	12	12	13	13	29
8	oth-F Brink	unk	E3b	13	24	13	10	16	18	11	12	14	13	11	30
9	oth-SA Brink	unk		13	24	15	10	11	14	12	12	12	13	13	30
10	oth-SP Brink	unk		13	24	15	10	11	14	12	12	12	13	13	30
11	oth-SM Brinks	unk		13	23	14	11	11	14	12	12	12	13	13	30

note: Participant 001 is believed to be a direct Y-chromosome descendant of
Lambert Huybertse (Brink), a man born in the early 1600's in The Netherlands and
who is believed to be the Y-chromosome ancestor of all of the early Brinks in the
North American Colonies and early states.

Participant 002 has an unknown European lineage, but is known to be a descendant of Washington Perry Brink, the founder of Brink's Express, now the Brinks Company. The first three markers differ between participants 001 and 002, although the other nine markers are the same.

FTDNA classified his haplogroup as H1b, a common one in Europe. More results
should allow a finer analysis of where the Brink lines came from.

TERMINOLOGY DEFINITIONS
these are non-technical definitions, as much as possible

locus	A location on a chromosome.
allele	This refers directly to the DNA coding -- specifically, in genetic genealogy, this is usually a set of STRs (short tandem repeats), short sequences of letters (base pairs) that are repeated 10-100 times. For example, the letter sequence GATA might be repeated 10 times. That allele would have the pattern: GATAGATAGATAGATAGATAGATAGATAGATAGATAGATA This means that when the chromosome is "sequenced" the location (locus) for this sequence would be identified as having 10 repeats. A mutation at this locus might result in an additional GATA to be inserted thus making the STR count to increase to 11. The allele numbers in the table above refers to the numbers of repeats (STRs) at the tested locations. It is these repeats that are used to determine closeness of relationship.
haplogroup	Haplogroups are constructed through a mathematical comparison of the DNA data from thousands of individuals. Individuals with many identical alleles would likely be classified in the same haplogroup. Y-DNA haplogroup R1b is strongly associated with Western Europe. There has been a great deal of research on the distribution and migration of population haplogroups around the world.
markers	Alleles/mutations that are used as tools by researchers to identify something, such as closeness of relation or inherited diseases.