Interpretation of Brink DNA test results

Interpretation of the Y-DNA Test Results
for participants in this project, et al.

It is too early for many lineage comparisons -- more data are needed.
The preliminary conclusion is that this is a very diverse group. See the comparison table given
below for comparisons with the Super Western Atlantic Modal Haplotype.

About Haplogroup R1b
and the "Super Western Atlantic Modal Haplotype"
Some of this information is from articles written by Dr. Whit Athey.

Our comparisons with the Super Western Atlantic Modal Haplotype (SWAMH), etc.
the information is presented for only the first 12 markers, red represents a mismatch

The people listed in rows 3 and 6-7 had the closest matches to the SWAMH, although FTDNA classified the
Y-DNA given in row 2 as R1b1.

The research literature provides the following explanation of the origins of the R1b haplogroup. It is believed that during the Last Glacial Maximum the people bearing the R1b haplogroup over wintered in Iberia, and after the glacial retreat about 12,000 years before present, began a migration to the north in large numbers, and to the east in declining numbers (although probably arriving in Spain from the east 30,000 years ago among the paleolithic or "old stone age" peoples considered to be aboriginal to Europe). It is believed that everyone who is R1b is a descendant in the male line from an individual known as "the patriarch" since his descendants account for over 40% of all the chromosomes of Europe. This haplogroup is characteristic of the Basques whose language is probably that of the first R1b, and who are genetically the closest to the original R1b population (which probably amounted to only a few thousand individuals).

TERMINOLOGY DEFINITIONS
these are non-technical definitions, as much as possible

locus	A location on a chromosome.
allele	This refers directly to the DNA coding -- specifically, in genetic genealogy, this is usually a set of STRs (short tandem repeats), short sequences of letters (base pairs) that are repeated 10-100 times. For example, the letter sequence GATA might be repeated 10 times. That allele would have the pattern: GATAGATAGATAGATAGATAGATAGATAGATAGATAGATA This means that when the chromosome is "sequenced" the location (locus) for this sequence would be identified as having 10 repeats. A mutation at this locus might result in an additional GATA to be inserted thus making the STR count to increase to 11. The allele numbers in the table above refers to the numbers of repeats (STRs) at the tested locations. It is these repeats that are used to determine closeness of relationship.
haplogroup	Haplogroups are constructed through a mathematical comparison of the DNA data from thousands of individuals. Individuals with many identical alleles would likely be classified in the same haplogroup. Y-DNA haplogroup R1b is strongly associated with Western Europe. There has been a great deal of research on the distribution and migration of population haplogroups around the world.
markers	Alleles/mutations that are used as tools by researchers to identify something, such as closeness of relation or inherited diseases.

row	identification	test date	Haplo- group	393	390	19(394)	391	385a	385b	426	388	439	389-1	392	389-2
1	001 Brink	2006	R1b1	14	25	15	10	11	14	12	12	12	14	13	30
2	002 Brink	2006	R1b1	13	24	14	10	11	14	12	12	12	14	13	30
3	003 Brinck	2008	R1a	13	25	16	10	11	14	12	12	11	13	11	29
4	004 Brink	2008	Q1a3	13	24	13	10	15	18	12	12	11	12	16	29
5	005 Brink	2008	G	12	22	15	10	14	15	11	13	12	12	11	29
6	oth-F Brink	unk	E3b	13	24	13	10	16	18	11	12	14	13	11	30
7	oth-SA Brink	unk		13	24	15	10	11	14	12	12	12	13	13	30
8	oth-SP Brink	unk		13	24	15	10	11	14	12	12	12	13	13	30
9	oth-SM Brinks	unk		13	23	14	11	11	14	12	12	12	13	13	30

row	identification	test date	Haplo- group	SWAMH match	393	390	19(394)	391	385a	385b	426	388	439	389-1	392	389-2
1	SWAMH-modal	n/a	R1b	n/a	13	24	14	11	11	14	12	12	12	13	13	29
2	001 Brink	2006	R1b1	6/12	14	25	15	10	11	14	12	12	12	14	13	30
3	002 Brink	2006	R1b1	9/12	13	24	14	10	11	14	12	12	12	14	13	30
4	003 Brinck	2008	R1a	7/12	13	25	16	10	11	14	12	12	11	13	11	29
5	oth-F Brink	unk	E3b	4/12	13	24	13	10	16	18	11	12	14	13	11	30
6	oth-SA Brink	unk	prob R1b?	9/12	13	24	15	10	11	14	12	12	12	13	13	30
7	oth-SP Brink	unk	prob R1b?	9/12	13	24	15	10	11	14	12	12	12	13	13	30
8	oth-SM Brinks	unk	prob R1b?	10/12	13	23	14	11	11	14	12	12	12	13	13	30

row	identification	test date	Haplo- group	SWAMH match	393	390	19(394)	391	385a	385b	426	388	439	389-1	392	389-2
1	SWAMH-modal	n/a	R1b	n/a	13	24	14	11	11	14	12	12	12	13	13	29
2
3	002 Brink	2006	R1b1	9/12	13	24	14	10	11	14	12	12	12	14	13	30
4
5
6	oth-SA Brink	unk	prob R1b?	9/12	13	24	15	10	11	14	12	12	12	13	13	30
7	oth-SP Brink	unk	prob R1b?	9/12	13	24	15	10	11	14	12	12	12	13	13	30
8	oth-SM Brinks	unk	prob R1b?	10/12	13	23	14	11	11	14	12	12	12	13	13	30